MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2025-10-17, 06:43 AEDT based on data in: /data/group/frankslab/project/LFlorence/NitrogenDeposition-AusForests/am_fungi/data/primers_trimmed

General Statistics

Showing ²⁵⁶/₂₅₆ rows and ⁴/₆ columns.

Sample Name	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
m10_R1	94.7%	46%	565bp	284bp	45%	0.0M
m10_R2	84.8%	44%	549bp	274bp	55%	0.0M
m11_R1	92.3%	45%	568bp	284bp	45%	0.1M
m11_R2	83.7%	44%	548bp	274bp	55%	0.1M
m12_R1	92.3%	45%	563bp	284bp	45%	0.0M
m12_R2	76.8%	44%	549bp	274bp	55%	0.0M
m13_R1	97.1%	46%	566bp	284bp	36%	0.1M
m13_R2	88.7%	44%	551bp	274bp	45%	0.1M
m14_R1	92.0%	44%	565bp	284bp	45%	0.0M
m14_R2	82.3%	42%	548bp	274bp	55%	0.0M
m15_R1	92.0%	44%	566bp	284bp	45%	0.0M
m15_R2	82.4%	42%	548bp	274bp	55%	0.0M
m16_R1	90.2%	46%	556bp	284bp	45%	0.0M
m16_R2	78.3%	44%	543bp	274bp	55%	0.0M
m17_R1	94.1%	47%	559bp	284bp	36%	0.0M
m17_R2	86.9%	44%	547bp	274bp	55%	0.0M
m18_R1	92.6%	46%	566bp	284bp	36%	0.1M
m18_R2	83.0%	44%	548bp	274bp	55%	0.1M
m19_R1	94.9%	47%	564bp	284bp	36%	0.1M
m19_R2	86.9%	44%	549bp	274bp	45%	0.1M
m1_R1	94.9%	47%	564bp	284bp	36%	0.1M
m1_R2	88.1%	44%	550bp	274bp	45%	0.1M
m20_R1	89.8%	46%	565bp	284bp	45%	0.1M
m20_R2	78.6%	44%	547bp	274bp	55%	0.1M
m21_R1	93.7%	43%	563bp	284bp	45%	0.1M
m21_R2	83.7%	41%	546bp	274bp	55%	0.1M
m22_R1	90.8%	45%	566bp	284bp	36%	0.0M
m22_R2	81.7%	44%	547bp	274bp	55%	0.0M
m23_R1	96.5%	46%	562bp	284bp	45%	0.1M
m23_R2	85.7%	44%	551bp	274bp	55%	0.1M
m24_R1	94.0%	45%	562bp	284bp	36%	0.0M
m24_R2	84.0%	44%	547bp	274bp	45%	0.0M
m25_R1	97.7%	46%	564bp	284bp	36%	0.7M
m25_R2	92.0%	43%	546bp	274bp	45%	0.7M
m26_R1	92.2%	46%	564bp	284bp	36%	0.0M
m26_R2	82.2%	44%	548bp	274bp	55%	0.0M
m27_R1	95.4%	46%	564bp	284bp	45%	0.1M
m27_R2	87.4%	43%	546bp	274bp	55%	0.1M
m28_R1	95.3%	45%	565bp	284bp	45%	0.1M
m28_R2	85.2%	43%	538bp	274bp	55%	0.1M
m29_R1	94.3%	46%	563bp	284bp	36%	0.1M
m29_R2	87.2%	45%	547bp	274bp	55%	0.1M
m2_R1	88.7%	46%	569bp	284bp	36%	0.1M
m2_R2	80.1%	44%	548bp	274bp	45%	0.1M
m31_R1	92.4%	45%	564bp	284bp	45%	0.0M
m31_R2	82.1%	42%	547bp	274bp	55%	0.0M
m32_R1	94.9%	45%	566bp	284bp	45%	0.3M
m32_R2	89.2%	43%	547bp	274bp	55%	0.3M
m33_R1	90.5%	47%	565bp	284bp	45%	0.0M
m33_R2	76.4%	44%	548bp	274bp	55%	0.0M
m34_R1	96.1%	45%	565bp	284bp	45%	0.3M
m34_R2	88.4%	44%	547bp	274bp	55%	0.3M
m35_R1	93.3%	48%	566bp	284bp	36%	0.1M
m35_R2	86.1%	44%	547bp	274bp	55%	0.1M
m36_R1	92.7%	47%	566bp	284bp	45%	0.3M
m36_R2	84.9%	43%	547bp	274bp	55%	0.3M
m37_R1	92.9%	46%	567bp	284bp	36%	0.1M
m37_R2	84.6%	44%	547bp	274bp	45%	0.1M
m38_R1	91.1%	47%	563bp	284bp	45%	0.0M
m38_R2	81.2%	45%	547bp	274bp	55%	0.0M
m39_R1	97.6%	45%	565bp	284bp	36%	1.3M
m39_R2	94.4%	44%	547bp	274bp	45%	1.3M
m3_R1	90.3%	46%	569bp	284bp	36%	0.1M
m3_R2	82.6%	44%	548bp	274bp	45%	0.1M
m40_R1	96.9%	46%	566bp	284bp	36%	1.1M
m40_R2	91.8%	43%	548bp	274bp	45%	1.1M
m41_R1	98.2%	47%	563bp	284bp	36%	1.3M
m41_R2	93.6%	44%	545bp	274bp	45%	1.3M
m42_R1	85.7%	46%	566bp	284bp	45%	0.0M
m42_R2	73.3%	44%	548bp	274bp	55%	0.0M
m43_R1	94.9%	48%	563bp	284bp	36%	0.1M
m43_R2	87.1%	44%	552bp	274bp	45%	0.1M
m44_R1	90.1%	46%	567bp	284bp	45%	0.1M
m44_R2	80.8%	43%	548bp	274bp	55%	0.1M
m45_R1	93.8%	46%	565bp	284bp	45%	0.1M
m45_R2	83.8%	44%	548bp	274bp	55%	0.1M
m46_R1	93.2%	45%	562bp	284bp	45%	0.0M
m46_R2	81.9%	43%	546bp	274bp	55%	0.0M
m4_R1	93.8%	45%	565bp	284bp	45%	0.0M
m4_R2	84.4%	43%	549bp	274bp	55%	0.0M
m5_R1	96.7%	46%	566bp	284bp	45%	0.6M
m5_R2	90.3%	43%	548bp	274bp	55%	0.6M
m6_R1	97.3%	47%	565bp	284bp	36%	0.1M
m6_R2	88.4%	45%	548bp	274bp	45%	0.1M
m7_R1	96.3%	45%	566bp	284bp	36%	0.2M
m7_R2	91.0%	42%	549bp	274bp	45%	0.2M
m8_R1	95.0%	45%	566bp	284bp	36%	0.1M
m8_R2	87.6%	43%	548bp	274bp	45%	0.1M
m9_R1	93.9%	46%	567bp	284bp	45%	0.0M
m9_R2	81.7%	45%	550bp	274bp	55%	0.0M
neg1_R1	81.3%	71%	116bp	34bp	73%	0.0M
neg1_R2	79.9%	83%	220bp	34bp	91%	0.0M
neg2_R1	82.9%	63%	99bp	34bp	73%	0.0M
neg2_R2	83.8%	83%	198bp	34bp	91%	0.0M
s12428_R1	94.5%	46%	562bp	284bp	36%	0.0M
s12428_R2	86.0%	44%	546bp	274bp	55%	0.0M
s12430_R1	95.9%	45%	566bp	284bp	36%	0.1M
s12430_R2	86.0%	43%	550bp	274bp	45%	0.1M
s12438_R1	98.1%	46%	567bp	284bp	45%	0.5M
s12438_R2	91.4%	44%	550bp	274bp	55%	0.5M
s12614_R1	98.5%	44%	564bp	284bp	36%	0.5M
s12614_R2	93.1%	42%	550bp	274bp	45%	0.5M
s12884_R1	95.8%	46%	566bp	284bp	45%	0.1M
s12884_R2	83.4%	45%	551bp	274bp	55%	0.1M
s12903_R1	97.5%	45%	566bp	284bp	36%	0.5M
s12903_R2	91.0%	43%	548bp	274bp	45%	0.5M
s138530_R1	95.7%	47%	566bp	284bp	36%	0.1M
s138530_R2	88.8%	44%	548bp	274bp	45%	0.1M
s15825_R1	81.4%	48%	569bp	284bp	45%	0.0M
s15825_R2	69.3%	46%	548bp	274bp	55%	0.0M
s15827_R1	84.5%	47%	568bp	284bp	36%	0.0M
s15827_R2	72.2%	45%	547bp	274bp	55%	0.0M
s15829_R1	78.0%	46%	564bp	284bp	36%	0.0M
s15829_R2	61.2%	45%	544bp	274bp	45%	0.0M
s15947_R1	97.1%	45%	565bp	284bp	45%	0.1M
s15947_R2	88.1%	43%	552bp	274bp	55%	0.1M
s15949_R1	97.6%	45%	564bp	284bp	45%	0.1M
s15949_R2	88.8%	43%	549bp	274bp	55%	0.1M
s15965_R1	97.6%	45%	565bp	284bp	36%	0.2M
s15965_R2	89.6%	43%	549bp	274bp	45%	0.2M
s15981_R1	92.7%	44%	566bp	284bp	45%	0.0M
s15981_R2	81.7%	42%	548bp	274bp	55%	0.0M
s15987_R1	97.4%	46%	565bp	284bp	36%	0.2M
s15987_R2	90.3%	44%	549bp	274bp	45%	0.2M
s15997_R1	94.9%	44%	565bp	284bp	45%	0.0M
s15997_R2	83.2%	42%	549bp	274bp	55%	0.0M
s16001_R1	97.4%	46%	565bp	284bp	36%	0.2M
s16001_R2	91.2%	43%	549bp	274bp	45%	0.2M
s19481_R1	97.6%	46%	566bp	284bp	45%	0.3M
s19481_R2	89.8%	43%	549bp	274bp	55%	0.3M
s19501_R1	94.3%	46%	566bp	284bp	45%	0.1M
s19501_R2	85.4%	44%	549bp	274bp	55%	0.1M
s19505_R1	93.0%	46%	565bp	284bp	36%	0.1M
s19505_R2	84.6%	44%	548bp	274bp	45%	0.1M
s19507_R1	90.1%	46%	567bp	284bp	45%	0.0M
s19507_R2	75.3%	44%	549bp	274bp	55%	0.0M
s19509_R1	86.3%	47%	568bp	284bp	45%	0.0M
s19509_R2	72.8%	46%	547bp	274bp	55%	0.0M
s19511_R1	97.5%	49%	563bp	284bp	45%	0.1M
s19511_R2	88.5%	46%	548bp	274bp	55%	0.1M
s19594_R1	92.5%	47%	567bp	284bp	45%	0.0M
s19594_R2	84.2%	45%	548bp	274bp	55%	0.0M
s39300_R1	81.2%	49%	571bp	284bp	36%	0.0M
s39300_R2	70.9%	47%	547bp	274bp	55%	0.0M
s39314_R1	86.1%	49%	572bp	284bp	36%	0.0M
s39314_R2	76.9%	47%	547bp	274bp	45%	0.0M
s39326_R1	95.8%	43%	566bp	284bp	36%	0.1M
s39326_R2	89.3%	41%	549bp	274bp	45%	0.1M
s39352_R1	87.7%	46%	566bp	284bp	45%	0.0M
s39352_R2	77.9%	45%	548bp	274bp	55%	0.0M
s401612_R1	94.0%	45%	566bp	284bp	36%	0.1M
s401612_R2	86.0%	43%	548bp	274bp	45%	0.1M
s401614_R1	89.9%	45%	567bp	284bp	36%	0.0M
s401614_R2	79.0%	42%	549bp	274bp	55%	0.0M
s401616_R1	89.5%	46%	569bp	284bp	36%	0.0M
s401616_R2	79.7%	43%	549bp	274bp	45%	0.0M
s401618_R1	88.1%	46%	569bp	284bp	36%	0.0M
s401618_R2	78.7%	43%	548bp	274bp	55%	0.0M
s401620_R1	89.6%	47%	567bp	284bp	45%	0.0M
s401620_R2	78.5%	44%	548bp	274bp	55%	0.0M
s401622_R1	94.1%	46%	566bp	284bp	45%	0.1M
s401622_R2	83.9%	43%	549bp	274bp	55%	0.1M
s401632_R1	86.1%	47%	571bp	284bp	36%	0.0M
s401632_R2	78.3%	45%	548bp	274bp	45%	0.0M
s401634_R1	89.5%	46%	569bp	284bp	36%	0.0M
s401634_R2	77.9%	45%	548bp	274bp	55%	0.0M
s401644_R1	87.8%	46%	567bp	284bp	45%	0.0M
s401644_R2	74.0%	44%	546bp	274bp	55%	0.0M
s401646_R1	89.9%	47%	568bp	284bp	36%	0.0M
s401646_R2	80.9%	45%	547bp	274bp	55%	0.0M
s401650_R1	80.2%	48%	571bp	284bp	36%	0.0M
s401650_R2	72.1%	47%	546bp	274bp	45%	0.0M
s401652_R1	96.8%	44%	568bp	284bp	36%	0.3M
s401652_R2	90.2%	41%	550bp	274bp	45%	0.3M
s401654_R1	97.6%	47%	564bp	284bp	45%	0.1M
s401654_R2	90.3%	43%	550bp	274bp	45%	0.1M
s401656_R1	98.0%	47%	565bp	284bp	45%	0.2M
s401656_R2	92.4%	44%	548bp	274bp	45%	0.2M
s401658_R1	85.8%	45%	563bp	284bp	45%	0.0M
s401658_R2	64.4%	44%	548bp	274bp	55%	0.0M
s401660_R1	97.3%	47%	565bp	284bp	36%	0.2M
s401660_R2	90.3%	45%	549bp	274bp	45%	0.2M
s401954_R1	95.8%	44%	566bp	284bp	45%	0.1M
s401954_R2	85.1%	43%	549bp	274bp	55%	0.1M
s401956_R1	85.5%	46%	566bp	284bp	45%	0.0M
s401956_R2	72.6%	43%	547bp	274bp	55%	0.0M
s401964_R1	97.5%	45%	564bp	284bp	36%	0.1M
s401964_R2	90.5%	43%	548bp	274bp	55%	0.1M
s401972_R1	92.9%	45%	568bp	284bp	36%	0.1M
s401972_R2	83.3%	44%	549bp	274bp	45%	0.1M
s401974_R1	97.6%	44%	565bp	284bp	36%	0.3M
s401974_R2	89.7%	42%	549bp	274bp	45%	0.3M
s401978_R1	96.6%	44%	565bp	284bp	45%	0.1M
s401978_R2	81.3%	43%	549bp	274bp	55%	0.1M
s401996_R1	95.6%	46%	564bp	284bp	36%	0.1M
s401996_R2	87.4%	45%	546bp	274bp	45%	0.1M
s402006_R1	93.9%	47%	552bp	284bp	36%	0.0M
s402006_R2	81.9%	46%	536bp	274bp	55%	0.0M
s402112_R1	96.0%	46%	564bp	284bp	45%	0.1M
s402112_R2	85.4%	44%	548bp	274bp	55%	0.1M
s402116_R1	88.0%	46%	568bp	284bp	36%	0.0M
s402116_R2	82.2%	44%	542bp	274bp	45%	0.0M
s402118_R1	86.9%	45%	565bp	284bp	45%	0.0M
s402118_R2	73.1%	43%	547bp	274bp	55%	0.0M
s402120_R1	89.8%	45%	564bp	284bp	45%	0.0M
s402120_R2	79.5%	43%	545bp	274bp	55%	0.0M
s402122_R1	87.2%	47%	570bp	284bp	36%	0.0M
s402122_R2	76.9%	45%	548bp	274bp	55%	0.0M
s402124_R1	90.1%	45%	566bp	284bp	36%	0.0M
s402124_R2	81.5%	44%	547bp	274bp	55%	0.0M
s402150_R1	92.4%	44%	565bp	284bp	45%	0.0M
s402150_R2	80.9%	42%	547bp	274bp	55%	0.0M
s62120_R1	92.2%	45%	566bp	284bp	36%	0.0M
s62120_R2	80.1%	44%	549bp	274bp	55%	0.0M
s62128_R1	97.6%	48%	565bp	284bp	36%	0.2M
s62128_R2	91.7%	44%	551bp	274bp	45%	0.2M
s62134_R1	85.3%	50%	574bp	284bp	36%	0.0M
s62134_R2	78.1%	48%	548bp	274bp	55%	0.0M
s62150_R1	92.8%	45%	567bp	284bp	45%	0.1M
s62150_R2	83.1%	44%	548bp	274bp	45%	0.1M
s62152_R1	92.6%	45%	568bp	284bp	36%	0.1M
s62152_R2	84.5%	44%	548bp	274bp	45%	0.1M
s62154_R1	98.3%	41%	565bp	284bp	45%	0.2M
s62154_R2	94.0%	38%	549bp	274bp	55%	0.2M
s62156_R1	93.0%	45%	566bp	284bp	36%	0.1M
s62156_R2	84.1%	43%	548bp	274bp	55%	0.1M
s62158_R1	93.8%	45%	566bp	284bp	36%	0.1M
s62158_R2	85.3%	43%	548bp	274bp	45%	0.1M
s62160_R1	91.9%	46%	568bp	284bp	36%	0.1M
s62160_R2	84.3%	44%	549bp	274bp	45%	0.1M
s62162_R1	95.3%	43%	567bp	284bp	36%	0.1M
s62162_R2	86.7%	42%	549bp	274bp	45%	0.1M
s62164_R1	92.1%	46%	565bp	284bp	36%	0.0M
s62164_R2	83.5%	44%	548bp	274bp	45%	0.0M
s62166_R1	91.7%	46%	567bp	284bp	45%	0.0M
s62166_R2	80.6%	44%	549bp	274bp	55%	0.0M
s62168_R1	92.8%	45%	567bp	284bp	36%	0.0M
s62168_R2	84.7%	43%	548bp	274bp	45%	0.0M
s62170_R1	89.8%	47%	565bp	284bp	36%	0.0M
s62170_R2	81.1%	45%	547bp	274bp	45%	0.0M
s62172_R1	90.2%	47%	569bp	284bp	36%	0.0M
s62172_R2	81.6%	45%	548bp	274bp	55%	0.0M
s62174_R1	89.7%	47%	569bp	284bp	36%	0.0M
s62174_R2	81.6%	45%	548bp	274bp	55%	0.0M
s7839_R1	88.2%	44%	563bp	284bp	45%	0.0M
s7839_R2	68.9%	42%	546bp	274bp	55%	0.0M
s7857_R1	98.7%	46%	565bp	284bp	45%	0.5M
s7857_R2	92.7%	44%	549bp	274bp	55%	0.5M
s7863_R1	94.2%	45%	567bp	284bp	45%	0.1M
s7863_R2	84.1%	42%	548bp	274bp	55%	0.1M
s9450_R1	93.3%	47%	568bp	284bp	36%	0.1M
s9450_R2	86.2%	44%	548bp	274bp	45%	0.1M
s9466_R1	91.7%	44%	564bp	284bp	45%	0.0M
s9466_R2	76.8%	42%	548bp	274bp	55%	0.0M
s9586_R1	94.5%	45%	567bp	284bp	36%	0.1M
s9586_R2	87.3%	43%	547bp	274bp	45%	0.1M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC	% Dups	% Duplicate Reads	`percent_duplicates`
\|\|	FastQC	% GC	Average % GC Content	`percent_gc`
\|\|	FastQC	Average Read Length	Average Read Length (bp)	`avg_sequence_length`
\|\|	FastQC	Median Read Length	Median Read Length (bp)	`median_sequence_length`
\|\|	FastQC	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`
\|\|	FastQC	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

FastQC

Version:


                      
                        0.12.1

Quality control tool for high throughput sequencing data.URL: http://www.bioinformatics.babraham.ac.uk/projects/fastqc

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (e.g. PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
CCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACC	126	2342675	7.3417%
CCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAATT	126	2751946	8.6243%
CCAGTAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATT	126	304221	0.9534%
CCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATT	126	344995	1.0812%
CCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACT	126	1358023	4.2559%
CCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATT	126	548684	1.7195%
CCAATAGCGTATATTAAAATTGTTGCAGTTAAAAAGCTCGTAGTTGGATT	126	198582	0.6223%
CATAAGGTGCGAATGAAGTCGAAAATGCAACGTTCACTCATCCCTAGTCG	126	329103	1.0314%
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	126	81564	0.2556%
CCAATAGCGTATATTAAAGTTGTTGCGGTTAAAAAGCTCGTAGTTGGATC	125	1078955	3.3813%
CATAAGGTGCCAAACAAGTCAAAATATCCTTGCCTGATCCCTAGTCGGCA	123	487993	1.5293%
CGTAAGGTGCCGAACGGGTCATCATAGAATCCCGTCCGATCCCTAGTCGG	122	352904	1.1060%
CCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTCGAATT	120	89075	0.2792%
CCAATAGCGTATACTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAATT	118	61848	0.1938%
CCAATAGCGTATATTAAAGTTGTTGTGGTTAAAAAGCTCGTAGTTGAACC	116	95582	0.2995%
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN	116	15447	0.0484%
CCAAGAGCATATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATT	115	54190	0.1698%
CATAAGGTGCGGATGAAGTCGAAAATGCAACGTTCACCCATCCCTAGTTG	115	60855	0.1907%
CCAATAGCGTATATTAAAGTTGTTGCCGTTAAAAAGCTCGTAGTTGAACC	114	816615	2.5592%
CATAAGGTGCCAAACAAGTCAAAAAATCCTTGTCTGATCCCTAGTCGGCA	113	237575	0.7445%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID
\|\|	FastQC	Samples	Number of samples where this sequence is overrepresented	`samples`
\|\|	FastQC	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`
\|\|	FastQC	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Software	Version
FastQC	`0.12.1`

v1.24.1

MultiQC Toolbox

Highlight Samples

Rename Samples

Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

FastQC

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Rollover for sample name

Per Sequence GC Content

Per Base N Content

Sequence Length Distribution

Sequence Duplication Levels

Overrepresented sequences by sample

Top overrepresented sequences

Adapter Content

Status Checks

Software Versions

Toggle navigation v1.24.1

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

FastQC

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

v1.24.1

Highlight Samples

Rename Samples

Show / Hide Samples

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks